Jurassic World - DNA Profile

[Pocko]

I was trawling through the Masrani Global and Jurassic World websites and came across an image in the "Assembly" section of the Creation Lab.



It got me wondering if I could get close to replicating the DNA profile in Photoshop. It's my first go at replicating something directly, so hopefully it's somewhere near. (Though I know it's not exact!)

Not much of note for the actual process. A lot of repetition, mainly! If anyone has any specific questions, I'll try my best to answer them.

The ID card is a high-res copy of the download from the Masrani website, all other items are found/bought.

 

[Mike J.]

Re: Jurassic World DNA Profile

*****, you did that in Photoshop? Did you re-draw everything from scratch?

 

[Pocko]

Re: Jurassic World DNA Profile

Hi Mike J, thanks for the comment.

Everything from scratch, apart from the logos, the triceratops silhouette and the DNA strand in the top left corner.

The concentric rings were done using a tall, thin rectangle brush. With the right jitter on opacity etc, I then just set it to stroke a circular path. The inner circles were a bit of a pain. I did those in one colour then sectioned off bits to adjust with hue/saturation.

 

[Mike J.]

Re: Jurassic World DNA Profile

You did a great job

 

[paulp]

Re: Jurassic World DNA Profile

Turned out really nice. My first thought was, you should have used Illustrator, but the adjustments you needed to do made it more PS. Hopefully you were working pretty high res. Impressive nonetheless.

 

[typeomega]

Re: Jurassic World DNA Profile

grate job, i want one. that's some serious time in Photoshop to do all that. just for fun i would love one with a Godzilla silhouette :lol the original reference photo almost looks like it printed on a transparency film. i can see notebook paper behind it and the clear part above the right hand dosent quite look like lamination.

 

[Pocko]

Re: Jurassic World DNA Profile

Thanks everyone!

paulp, it is very hi-res, most likely overkill for the size of the prop. Also, I have absolutely no experience with Illustrator!

typeomega, you're so right! It's amazing what a fresh set of eyes can reveal. Just goes to show you can convince yourself of something, even when you're checking your reference 100s of times. If it was laminated the blue of the gloves would show through on the edges :s

There's definitely 3 layers there. The DNA profile, a lined sheet, and a grey backboard of some kind. The DNA profile also appears to be hole-punched.

I also forgot the tiny text between the two innermost rings. No idea what it might say. I was going to go with something like gattaaccctttagggacccttaa etc etc.

 

[KevinBGoode]

Re: Jurassic World DNA Profile

Awesome Job!

 

[Mike J.]

Re: Jurassic World DNA Profile

See, I just would have done a Google Image Search, and stolen something that looked close...

This looks close, and that tiny type you mentioned is just dashes...

http://nsf.gov/news/mmg/media/images/corn_genome1_h.jpg

 

[typeomega]

Re: Jurassic World DNA Profile

not only dose it look close it looks identical. all i know is if triceratops taste anything like corn sign me up i'll take 3 ears err... horns ?

 

[Mike J.]

Re: Jurassic World DNA Profile

Here's a blow-up of the screen cap, and I adjusted the white balance.

 

[typeomega]

Re: Jurassic World DNA Profile

Pocko you are correct there seems to be 3 layer creation the effect of the lines underneath and not a transparency. i did not realize that cheap printer paper was so transparent as i always have it taped down to the desk when drawing on it. you did inspire me to make this though

i dont think i will be whole punching it but rather putting it up on the "inspiration wall" behind my desk

 

[Mike J.]

Re: Jurassic World DNA Profile

I'm having a hard time finding a similar Trike silhouette: head down, tip of the tail up...

Definitely not as easy as finding the 'genome' art.

Attached is a crappy silhouette of the Triceratops I managed to isolate from the screencap.

Let me know if you need some gibberish base pair 'GATTACAG' filler text: I drew some in 2004 for the replica of the JP novel GUI that I made in HTML class. That takes me back.


-MJ

 

[Mike J.]

Re: Jurassic World DNA Profile

Here's a better screencap (also white balanced).

 

[Mike J.]

Re: Jurassic World DNA Profile

I checked my 'making of JP' book, and didn't see a matching Trike silhouette. It was a long shot, anyway, but it's the only one I had.


-MJ

 

[Mike J.]

Re: Jurassic World DNA Profile

And the silhouette of the Trike we see on the DNA sheet is not the silhouette of the Trike used on the JW website, which strikes me as odd.

 

[Pocko]

Re: Jurassic World DNA Profile

Oh dear, I feel a bit foolish now I know its so easily available to google!

The silhouette was tough. I settled on using a side view from the Making of the Lost World (At lead I think that's why it looked so familiar!)

 

[Mike J.]

Re: Jurassic World DNA Profile

I'm redrawing the Trike in AI.

 

[Mike J.]

Re: Jurassic World DNA Profile

Tracked down a journal article that used the maize genome illustration: This was it's caption:

"Fig. 1. The maize B73 reference genome (B73 RefGen_v1): Concentric circles show aspects of the genome. Chromosome structure (A). Reference chromosomes with physical fingerprint contigs (11) as alternating gray and white bands. Presumed centromeric positions are indicated by red bands (31); enlarged for emphasis. Genetic map (B). Genetic linkage across the genome, on the basis of 6363 genetically and physically mapped markers (14, 19). Mu insertions (C). Genome mappings of nonredundant Mu insertion sites (14, 19). Methyl-filtration reads (D). Enrichment and depletion of methyl filtration. For each nonoverlapping 1-Mb window, read counts were divided by the total number of mapped reads. Repeats (E). Sequence coverage of TEs with RepeatMasker with all identified intact elements in maize. Genes (F). Density of genes in the filtered gene set across the genome, from a gene count per 1-Mb sliding window at 200-kb intervals. Sorghum synteny (G) and rice synteny (H). Syntenic blocks between maize and related cereals on the basis of 27,550 gene orthologs. Underlined blocks indicate alignment in the reverse strand. Homoeology map (I). Oriented homoeologous sites of duplicated gene blocks within maize."

I thought that might make good filler text for your documents, with the maize references replaced with "Triceratops," of course...


-MJ

 

[Mike J.]

Re: Jurassic World DNA Profile

Here is the ugliest Triceratops ever drawn by man.

Did I mention I toyed with redoing the genome map? I started with the green ring, and was able to get an 'OK' looking facsimile in Illustrator... but I quickly ran out of enthusiasm.

I'd love to get a higher-res version of the genome map. But I have looked all over the internet and can't find it any larger...

...On the plus side, I have no accumulated several similar genome images, in case someone wants to make a variant... T-Rex or whatever...


-MJ